The following code does something like what you need. Read it, consider it, and understand it. Post specific questions following site guidelines if anything is unclear.

#!/usr/bin/perl
use strict;
use warnings;

my $buffer = "";
my $series = 1;
$_ = <DATA>; # Skip first line
while (<DATA>) {
    if (/>/) {
        my @elements = split /N+/, $buffer;
        for my $i (1 .. @elements) {
            print ">Count$series.$i\n$elements[$i-1]\n";
        }
        $buffer = "";
        $series++;
    } else {
        chomp;
        $buffer .= $_;
    }
}
my @elements = split /N+/, $buffer;
for my $i (1 .. @elements) {
    print "Count$series.$i\n$elements[$i-1]\n";
}

__DATA__
>sequence1 123.3
ATGACGTAGACGATGAGTAGACGATAGCAGTGACAGGTGAGTG
ATGACGATGAGTAGAGACGGGGGTAGAGGGGGATAGATAGAGANNNNNNNN
ATAGACAGATAANNNNNNNNNNNNNNNNNAGATGAGACAGATANNNNNNN
>sequence2 143.5
ATGCGATGCNNNNNNCGTAGCTGANNNNNNCGATGCTGATGCTC
CGTAGTCTGCTAGCTAGTCNNNNNNCGTAGTCGATCGATCGANNNNNNCGTGCATGC
CGATGCTACGGATNNNNNCGATCGATCGATCGACNNNNNCGATCAGCTAG
CCCCGCTAGTCANNNNN
>sequence3 132.3
ATGCTGATCAGCTACGCTAGCNNNNNCGATCGATCGATCGACTAGCNNNNNNCGATCCGAGCT
CGATCGATCGATCGATCGANNNNNCGATCGATCGACTAGCNNNNNCGATCGATCGA
CGATCGATCGA
>C1132423 123.4
ATCGTGCATGCATCGATCGACTACGCTGCTACGATCGACTGCTAGCTACGCTAC
CGTCGATCGATCGACTACGCTGACTGACTAGCTAG
>C1123234 176.4
GCTAGCGATCGCACCGATCGATCGTACGCTACGATCGATCGATCGATCGACTGT
CGATCGATCGATCGATCGATCGA
>C1123546 531.1
CGTAGCTACGATCGATCGATCGACTAGCTACGATCGATCGACTAGCTAGCTAGCTAG
[download]

I will keep in mind about the things you mentioned above (sorry about Formatting, this was my first post).

I was trying something like this (just a snippet of my code):

$scafSeq = $ARGV[0];
open (IN, "< $scafSeq");

while ( $line = <IN> ) 
    {
        chomp $line;
        $line =~ s/^\s+//g;
        $line =~ s/sequence/count/g;
        next if $line eq "";

        if(substr($line,0,1) eq ">")
        {
            ($scaff) = $line =~ /^>(\S+)/;
        }
        else
        {
            $scaffData -> {$scaff} .= $line; 
        }
    }
[download]

And then I sort the keys and split it with N. Although this approach was sorting the data for >sequence1, etc , it was not working for >C1113456... data.

Your code is short and effective, to do this job. Thanks!

Perhaps BioPerl (website), BioPerl (CPAN), or BioPerl (google) might help.

In particular OP might want to check out Bio::SeqIO::fasta...

Just a something something...

I can't quite make out how you got the output from the input you provided. Maybe I'm just not seeing something obvious, but the rules that applied to the input to produce the output aren't clear to me. So I'll just offer some links that may be of help to a self-described newbie.

The perlretut Perl regular expression tutorial might be of some help. Also, I'm not sure of how new a newbie you are, but the perlopentut should help you get the file open, if you need that. Once you get the file open you can go through it's contents and use regular expressions to match text based on the rules you provide, and manipulate the text as needed.

Those articles are both at http://perldoc.perl.org - you might find the rest of the site helpful as well if you need a good reference.

Also, depending on where you work/study you might have access to Safari, an online service with electronic copies of a ton of good tech books. The O'Riely Perl books are quite good, and might be helpful. 'Programming Perl' was very useful and sat on my desk for a long time while I was learning Perl.

Sorry I couldn't offer anything more specific. Hopefully those will help.

Thanks a lot for all the information. I appreciate it.

Welcome to the Monastery!

You may like to proceed immediately to our very fine Tutorials, esp. Perl and Bioinformatics. Enjoy your stay.