comment on

Hello toolic, Thank you for that useful code. I found out that my bwa and Input hashes are okay because they share the same key (ID), but hash Amp does not share the same key! so it makes weird data structure like this:

Amp   $VAR1 = {
          'Seq1Perfect' => [],
          'Seq6TruncB' => [],
          'Seq7TruncF' => [],
          'Seq3In' => [],
          'TMEM200B' => [
                          'TMEM200B',
                          'TTTTTTTGTTTGGTTGGTTTTGATTTGAGTGGTTTTTTTGGTG
+TTTAGTTTAA                             GTTGTTTTTGTTGTAGTTTTGTTGTGGGTG
+GAGGAGGTTTGGAAGGAGGGGGTGGGTAGGGAGAGGTTGGAGTTGGTGAT                   
+          GTTTTTTTTTTTTGTGTTGTGGTATGTAAAGTATAGTAGGGGGGAGGTGGGGTTTGGTG
+AGTGATTTTTGTGGATTTGGG                             AGGTTTGAGTGTTTTTGTT
+TTATTTGTTATGGTGTAGTTATGTGTGGGGGTGGGGTTGAGTTTGGGAGGTATTTATTTTG        
+                     GAGA'
                        ],
          'Seq4Del' => [],
          'Seq2MM' => [],
          'B3GAT2-2_P001' => [
                               'B3GAT2-2_P001',
                               'GGTTGGTTTTTATTTTTTGGAAGAGTTTTAGATTATAG
+GTGTTGTTGT                             TGTTAGTGAAGAAGAGTATGTTGGGTTGTG
+TGTGTTGGTGTTGGTGTTTTTGGTGTAGTTAGGTGAGGTTTGTGTTGTGT                   
+          TGTTTAGTGGTGTGTGGTAGTTTGGGTTGTTTGTAGTGTTGTGGTGTGGGTATGTGTAG
+GTGAGTGTTGGGTAGTT'
                             ],
          'Seq5Partial' => []
        };
[download]

I will explain again... basically bwa is an alignment program and i already ran bwa so the bwa input file (input file #1 - .sam file) contain both Reference Amplicon ID and Input sequence ID.. Hash 'Amp' contains Reference Amplicon ID and Hash 'Input' contains Input sequence ID.. so a sequence from bwa file will have Reference Amplicon ID AND Input sequence ID both. So you use these two IDs to pick a sequence in Input file #2 (Reference Amplicon ID) and a sequence in Input file #3 (Input sequence ID) and trying to print them so I can compare them later (codes for this comparison is not added yet) Should I create nested foreach to use two different keys? or is there easier way?

In reply to Re^2: Matching strings from three files (three hashes) by FluffyBunny
in thread Matching strings from three files (three hashes) by FluffyBunny

Are you posting in the right place? Check out Where do I post X? to know for sure.
Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
<code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
Want more info? How to link or How to display code and escape characters are good places to start.


Clear questions and runnable code get the best and fastest answer
	PerlMonks