Beefy Boxes and Bandwidth Generously Provided by pair Networks
Don't ask to ask, just ask
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??

If you bitwise or (|) an uppercase letter with a space, (assuming latin-1/ASCII files), it will lowercase it:

print 'ACGT' | ' ';; acgt

So, if you translate all the 'N's in your mask to spaces and then bitwise or the sequence and the mask, it will achieve your goal very efficiently:

$s = 'GGTACACAGAAGCCAAAGCAGGCTCCAGGCTCTGAGCTGTCAGCACAGAGACCGAT';; $m = 'GGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT';; ( $mm = $m ) =~ tr[N][\x20];; print $mm;; GGT T print $s | $mm;; GGTacacagaagccaaagcaggctccaggctctgagctgtcagcacagagaccgaT

Which makes your entire program (excluding the unmentioned fact that your files may be in FASTA format):

#! perl -slw use strict; open SEQ, '<', 'data1.dat' or die $!; open MASK, '<', 'data2.dat' or die $!; while( my $seq = <SEQ> ) { ## Read a sequence my $mask = <MASK>; ## And the corresponding mask $mask =~ tr[N][ ]; ## Ns => spaces print $seq | $mask; ## bitwise-OR them and print the result } close SEQ; close MASK;

Redirect the output to a third file and you're done.


Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.

In reply to Re: Lower-casing Substrings and Iterating Two Files together by BrowserUk
in thread Lower-casing Substrings and Iterating Two Files together by neversaint

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others admiring the Monastery: (4)
As of 2024-04-24 22:19 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found