If you bitwise or (|) an uppercase letter with a space, (assuming latin-1/ASCII files), it will lowercase it:
print 'ACGT' | ' ';;
acgt
So, if you translate all the 'N's in your mask to spaces and then bitwise or the sequence and the mask, it will achieve your goal very efficiently:
$s = 'GGTACACAGAAGCCAAAGCAGGCTCCAGGCTCTGAGCTGTCAGCACAGAGACCGAT';;
$m = 'GGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT';;
( $mm = $m ) =~ tr[N][\x20];;
print $mm;;
GGT T
print $s | $mm;;
GGTacacagaagccaaagcaggctccaggctctgagctgtcagcacagagaccgaT
Which makes your entire program (excluding the unmentioned fact that your files may be in FASTA format):
#! perl -slw
use strict;
open SEQ, '<', 'data1.dat' or die $!;
open MASK, '<', 'data2.dat' or die $!;
while( my $seq = <SEQ> ) { ## Read a sequence
my $mask = <MASK>; ## And the corresponding mask
$mask =~ tr[N][ ]; ## Ns => spaces
print $seq | $mask; ## bitwise-OR them and print the result
}
close SEQ;
close MASK;
Redirect the output to a third file and you're done.
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority".
In the absence of evidence, opinion is indistinguishable from prejudice.
-
Are you posting in the right place? Check out Where do I post X? to know for sure.
-
Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
<code> <a> <b> <big>
<blockquote> <br /> <dd>
<dl> <dt> <em> <font>
<h1> <h2> <h3> <h4>
<h5> <h6> <hr /> <i>
<li> <nbsp> <ol> <p>
<small> <strike> <strong>
<sub> <sup> <table>
<td> <th> <tr> <tt>
<u> <ul>
-
Snippets of code should be wrapped in
<code> tags not
<pre> tags. In fact, <pre>
tags should generally be avoided. If they must
be used, extreme care should be
taken to ensure that their contents do not
have long lines (<70 chars), in order to prevent
horizontal scrolling (and possible janitor
intervention).
-
Want more info? How to link
or How to display code and escape characters
are good places to start.