Welcome to the Monastery | |
PerlMonks |
comment on |
( [id://3333]=superdoc: print w/replies, xml ) | Need Help?? |
Hello all;
I guess my earlier post was not very readable. I have a DNA sequence and I want to find all start codons(ATG,GTG,) and stop codons. I want to translate all possible subsequences betwen start and stop codons to their corresponding protein sequences.This should be on the 1st frame only. For instance; $Dna = "AAAATGGGGTAAGTGAACGGGTAA" should return the corresponding proteins of "ATGGGGTAA" and "GTGAACGGGTAA" but should work also for very long sequences . I tried to do something like this in the middle of my code:
But basically; I need to put all possible seubsequences between stats and stops, as above, in an array and then translate each of them I need help with this.Emman In reply to Orf subsequences by odegbon
|
|