Beefy Boxes and Bandwidth Generously Provided by pair Networks
We don't bite newbies here... much
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??

Does this do what you want? There is no need to split the sequence into an array as pos will allow you to find where in a string a match has been made. Note that [^ACGT] is a negative character class, i.e. match anything that isn't A, C, G or T. Using capturing parentheses, ( ... ), and matching globally, m{ ... }g or / ... /g will advance along the sequence looking for invalid letters.

I am opening a file that is held inside the script just to keep things tidy on my system but the code will work fine with STDIN. The code.

use 5.026; use warnings; open my $dnaFH, q{<}, \ <<__EOD__ or die $!; TAAGAACAATAAGAACAAGAACAATAA GAACAATAAGXAATAAGAAXXAACAAGAACAATAA ACAATAAAAGAACAATAAGAA __EOD__ while ( my $sequence = <$dnaFH> ) { chomp $sequence; my $length = length $sequence; say qq{Sequence: $sequence -- Length $length}; if ( $sequence =~ m{^[ACGT]+$} ) { say q{ Sequence is GOOD!}; } else { my @badPosns; push @badPosns, pos $sequence while $sequence =~ m{(?x) (?= ( [^ACGT] ) )}g; my $nBad = scalar @badPosns; my $perc = sprintf q{%.2f}, $nBad / $length * 100; say qq{ Sequence is BAD at @badPosns}; say qq{ $nBad bad positions, $perc\% of total}; } } close $dnaFH or die $!;

The output.

Sequence: TAAGAACAATAAGAACAAGAACAATAA -- Length 27 Sequence is GOOD! Sequence: GAACAATAAGXAATAAGAAXXAACAAGAACAATAA -- Length 35 Sequence is BAD at 10 19 20 3 bad positions, 8.57% of total Sequence: ACAATAAAAGAACAATAAGAA -- Length 21 Sequence is GOOD!

I hope this is helpful. Please ask further if you need more help.

Update: There was a mistake in the code, I should have used a look-ahead assertion as without that pos gives the position after the match, not that of the match itself. Added extended syntax ((?x)) to make the regex clearer. My bad :-(

Update 2: I should also have corrected the output, now done.

Cheers,

JohnGG


In reply to Re: Find element in array by johngg
in thread Find element in array by Sofie

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others wandering the Monastery: (2)
As of 2024-04-20 03:16 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found