how to search for a pattern in a string within a certain range

BhariD has asked for the wisdom of the Perl Monks concerning the following question:

If I have to search for a pattern in a string within certain range of the string then what should I specify?

For example

I have the following string:

 string1: ATGGCTAGTTTCAGT
 string2: GTTTATGGGTACGTGT
[download]

the search pattern is 'TTT'. I want to search the pattern in the start of the string (not in the middle or in the end), or only up till 8 characters, once pattern is identified, remove the characters before the pattern along with the pattern. so my output will be like:

 string1: ATGGCTAGTTTCAGT 
 string2: ATGGGTACGTGT
[download]

Can anyone help me please?

Thanks

Comment on how to search for a pattern in a string within a certain range Select or Download Code

Replies are listed 'Best First'.
Re: how to search for a pattern in a string within a certain range by ikegami (Patriarch) on Mar 08, 2010 at 03:37 UTC
This is so similar to your last question. So you want to match at most 8 characters before the sequence instead of any number of characters. Did you really not see anything relevant in perlre? What did you try?	[reply]
Re: how to search for a pattern in a string within a certain range by johngg (Canon) on Mar 08, 2010 at 13:41 UTC
Rather than using a regular expression, you might want to consider using index to find the first occurance of your search pattern. If it is found within your initial range then you could follow Ratazong's advice and use substr to remove characters as required. I hope this is helpful. Cheers, JohnGG	[reply]
Re^2: how to search for a pattern in a string within a certain range by ack (Deacon) on Mar 08, 2010 at 18:53 UTC
My toughts, too. Regex's seem like an overly complicated solution to me; but, on the other hand, it's a good problem to learn some pretty empowering Regex strategies. So "Your mileage may vary." Here is a quick sript that uses substr() and index() to find the search-for pattern and deletes everything up to the pattern plus that pattern. It also only searches up to the specified number of characters. Read more... (1111 Bytes) This script produces the following output: `ATGGCTAGTTTCAGT ---> ATGGCTAGTTTCAGT GTTTATGGGTACGTGT ---> ATGGGTACGTGT ATTGATACGGGTATTTAGGCTG ---> ATTGATACGGGTATTTAGGCTG ATTAGGAAGTAGGACCCTAGG ---> ATTAGGAAGTAGGACCCTAGG` [download] If I understand the OP's inquiry, I think this does what is wanted. The only thing I'm not clear on is what the OP expects to do if there are (1) multiple occurances, within the seek-or number of characters, of the search-for pattern in the string? and (2) what the result should be if there is a run of the search-for pattern (e.g., 'TTTTTTTTT' which has three intances of the search-for pattern in a run)? ack Albuquerque, NM	[reply] [d/l] [select]
Re: how to search for a pattern in a string within a certain range by Ratazong (Monsignor) on Mar 08, 2010 at 07:24 UTC
Apart from Ikegami's suggestion, you might also reduce your string to its first 8 or 11 characters () and then apply your pattern-matching on the reduced string. Use substr for reducing the string. depending whether the TTT needs to be contained in the 8 characters or not	[reply]
Re^2: how to search for a pattern in a string within a certain range by moritz (Cardinal) on Mar 08, 2010 at 07:41 UTC
you might also reduce your string to its first 8 or 11 characters (*) 8 or 10 please. If the substring has to start within the first 8 characters, it can only extend 2 two character over the first 8. A typical Off-by-one error :-) Perl 6 - links to (nearly) everything that is Perl 6.	[reply]
Re: how to search for a pattern in a string within a certain range by Sinistral (Monsignor) on Mar 08, 2010 at 14:59 UTC
Considering the strings you are using contain A,T,G,C, I'm guessing you're trying to some sort of genetic analysis. I highly recommend you head on over to the BioPerl site and start reading. They have optimized solutions in Perl for handling huge data sets of nucleotide sequences and doing matching and reporting.	[reply]


Welcome to the Monastery
	PerlMonks