print join'',unpack 'C*',   
  'AGGCGGAAGCACCCAACAGCAACAG' 
^ 'ACACGCAAAAACCGAAGAGAAAGCG';

0460040062000400400200420

##</code><code>##

print $_ = grep $_,unpack 'C*', 
  'AGGCGGAAGCACCCAACAGCAACAG' 
^ 'ACACGCAAAAACCGAAGAGAAAGCG';

10

##</code><code>##

#! perl -slw
use strict;
use bytes;
$| = 1;

our $FUZZY ||= 10;

open FUZ, '< :raw', $ARGV[ 0 ] or die "$ARGV[ 0 ] : $!";
my %fuz;
$fuz{ $_ } = '' while chomp( $_ = <FUZ> );
close FUZ;

print "Loaded ${ \scalar keys %fuz } 25-ers";

open SEQ, '< :raw', $ARGV[ 1 ] or die "$ARGV[ 1 ] : $!";

while( my $seq = <SEQ> ) {
	chomp $seq;

	for my $offset ( 0 .. length( $seq ) - 25 ) { 
		printf "\rProcessing sequence %5d offset %05d", $., $offset;

		for my $fuz ( keys %fuz ) {
			my $m =  grep $_, unpack 'C*', $fuz ^ substr( $seq, $offset, 25 );

			if( $m <= $FUZZY ) {
				
				## This stores the lineno/offset/fuzziness where each 25-er
				##  matched in a compact form for further process; sorting etc.
				$fuz{ $fuz } .= pack 'nnn', $., $offset, $m;
				
				## Or just print out the data to a file.
#				print "\nMatched '$fuz' -v- '", 
#					substr( $seq, $offset, 25 ),
#				"' in line: $. @ $offset with fuzziness: ", $m;
			}
		}
	}
}

close SEQ;