Beefy Boxes and Bandwidth Generously Provided by pair Networks
The stupid question is the question not asked
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??
Hello all;
I guess my earlier post was not very readable.

I have a DNA sequence and I want to find all start codons(ATG,GTG,) and stop codons. I want to translate all possible subsequences betwen start and stop codons to their corresponding protein sequences.This should be on the 1st frame only. For instance; $Dna = "AAAATGGGGTAAGTGAACGGGTAA" should return the corresponding proteins of "ATGGGGTAA" and "GTGAACGGGTAA" but should work also for very long sequences

. I tried to do something like this in the middle of my code:
while ($seq =~ m/ATG|TTG|CTG|ATT|CTA|GTG|ATT/gi){ my $matchPosition = pos($seq) - 3; if (($matchPosition % 3) == 0) { push (@startsRF1, $matchPosition); } while ($seq =~ m/TAG|TAA|TGA/gi){ my $matchPosition = pos($seq); if (($matchPosition % 3) == 0) { push (@stopsRF1, $matchPosition); }

But basically; I need to put all possible seubsequences between stats and stops, as above, in an array and then translate each of them

I need help with this.
Emman

In reply to Orf subsequences by odegbon

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others admiring the Monastery: (4)
As of 2024-04-20 12:31 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found