Beefy Boxes and Bandwidth Generously Provided by pair Networks
XP is just a number
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??
Hi all,
I am trying to write a perl script that will go to a web page (http://www.arabidopsis.org/Blast/),
select the right options from the drop down menus, fill in the Input text field, and then submit the form.
Here is my code:
#!/usr/local/bin/perl use strict; use lib "/common"; use LWP; my $browser = LWP::UserAgent->new; my $sequence = 'GTGACGAGGAGGAAGAAAGAGTGCGGTTGTTTTGTTTGACACTTCTTTTCTTTC +TCCTCCAACGGTCCAACTTTGACTCTCTCTTCTCTTCTCTGAAAATTCTTCTATTCATTCATCTTCCTA +TCTTTCCCATGGAAGTGGAACAACAACAATATCTTCTCCAATTTCTCTAACCCTAAATTAACCGCTTCA +CCGCACAATTTCATATTTCCTTTCTCTCTTTGATCGGTTATCATGTCCGTTTTGGTTGTAACCGCCATG +GATTTCGCCGTCCTCGGTTTTCTTATTCCCTCGCTCTGGGAGATCGAAGTCGCTTTCGCTGCCTCGCTT +TTCGTTATTCTCGCGTATTGGTTCTTCACATTTAGAATCGCTGACCGTCACTCCGATCGATCACTTTCG +GAAAATTCCGCCGGTGATTCCGCCGACGATAAAGTCAAGATTGGCCAGTCAAGAGGAGATTCTCAAGCC +GGTTCGGCGTACCTGATTAAGTTAGAACTATTGGCTGCTAAAAATCTGATAGCTGCAAATTTAAATGGC +ACATCGGATCCTTACACCATCATCACATGCGGCAATGAAAAGCGATTCAGTTCCATGGTCCCTGGTTCA +AGAAATCCAATGTGGGGCGAAGAGTTCAATTTTTCTGTCGATGAACTTCCTGTCCAGATCAATGTCACA +ATTTATGATTGGGATATAATTTGGAAAAGTGCTGTTCTTGGTTCAGTGACCGTTCCAGTTGAAAGTGAA +GGTCAAACTGGTGCAGTGTGGCATACTTTGGACAGCCCATCAGGGCAGGTTTGTCTTCATATAAAAACA +GAAAAAATGTCTGCAAATTCTGCCAGGATAAATGGTTATGGCGGAGCCAACACTCGAAGAAGGATACCC +TTGGAAAAACAGGAACCCACAGTAGTCCATCAAAAGCCAGGACCTCTTCAAACGATATTTGAGCTTCAT +CCAGATGAGGTTGTTGATCATAGTTACTCTTGTGCACTTGAAAGGTCATTCTTGTACCATGGTCGTATG +TATGTCTCAACATGGCACATTTGTTTCCATTCCAATGTGTTCTCGAAGCAAATGAAGGTGCTTATTCCG +TTTGAAGATATAGATGAGATTCGAAGGAGTCAACATGCATTTATTAATCCTGCTATAACAATTATTCTT +CGTATGGGTGCCGGTGGACATGGTGTCCCTCCTTTGGGAAGTCCTGATGGTAGAGTCAGATATAAGTTT +GCGTCATTTTGGAACAGGAATCATGCAGTTAGAAGTCTACAACGTGCTGTAAAGAACTTCCGTGAAATG +TTGGAAACTGAGAAGAAGGAAAATGCAGAGTCAGAATTGCGTGCACATAGCAGTTCTGTTAGACGAAGT +AACATAATGGATAAGGTTCCCGAAACCAGCATGCCAAAAGCTGGAAAACGTCAAACTTTTATCAAAGAA +GAGGCTTTAGTTGGTATATACAATGATGTTTTCCCCTGCACAGCAGAGCAGTTTTTTAACTTATTGTTA +AAGGACGATTCAAAATTTACTAGCAAGTATCGTTCAGCACGAAAGGATACTAATCTTGTGATGGGACAA +TGGCATACAGCAGAAGAATATGACGGTCAAGTCCGGGAGATAACCTTCAGATCCCTTTGTAACAGCCCT +ATGTGCCCGCCAGACACAGCCATTACTGAGTGGCAACATGTTGTTCTATCATCTGACAAGAAAAACCTG +GTGTTTGAGACTGTGCAACAGGCACACGATGTTCCACTCGGGTCCTGTTTTGAGGTGCACTGTAAATGG +GGTTTGGAGACAACTGGTGAAAGTTCATGTACTCTGGACATAAGAGTGGGTGCACATTTCAAGAAATGG +TGTGTGATGCAATCCAAAATAAAATCAGGGGCAATCAATGAGTACAAGAAAGAAGTTGATGTGATGTTA +GATGTTGCTCGTTCATATATAAAGCCGCATACTTCTGATGACGAGAATGATAAGGCATCTTCGCCCCCT +GCGGCAACTTTGGAAAATAAATTTTTCTGTGTAACCTTAGATTAGGACTTTGTTGGTCTGTGCAATATT +GTAACTTTCCTTCTCTTAAGTTATTTATTTATTCTTGCAACACAGCGCCCAAAGCCATGTATATTTATT +TTGATGCACAGTTGGTTTTTGTCTTGTGTATCTCTGTGGGTAACTTG'; my $URL = "http://www.arabidopsis.org/Blast/"; #BLASTX:NT query, AA db ->blastx #AGI Proteins (Protein) ->ATH1_pep #query sequence ->QueryText my $response = $browser->post( $URL, [ 'Algorithem' => 'blastx', 'BlastTargetSet' => 'ATH1_pep', 'QueryText' => $sequence, ] ); my $page = "/common/perlscripts/WebReading/page.html"; open(OUT,">$page") or die "can't open ", $page; print OUT $response->decoded_content; close(OUT);

I am trying to get the form to submit (the 'Run Blast' button), so that $response contains the data from the results page, but I can't figure out how to do that. If anyone knows a good web site for me to look or knows the answer, I would really appreciate it.
Thanks
Jon

In reply to Filling in a form on a web page using perl by jonp

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others perusing the Monastery: (2)
As of 2024-04-20 20:35 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found