In this case, it appears that yes, move(n,m) is the only operation with cost. (I'm not sure if it's cost is constant over all n,m. I think we're supposted to assume that it is.)
In purticular, this is going to be applied to a tape-library servicing robot, which only has one operation: switch the tapes in positions N and M. (move(n,m))
You're right about bubble-sort being a possiblity... but I don't think it's a good one. Remember that it isn't finding the sequence of moves that has to be done in constant space, it's the acautual movement of physical tapes.
TACCTGTTTGAGTGTAACAATCATTCGCTCGGTGTATCCATCTTTG
ACACAATGAATCTTTGACTCGAACAATCGTTCGGTCGCTCCGACGC
-
Are you posting in the right place? Check out Where do I post X? to know for sure.
-
Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
<code> <a> <b> <big>
<blockquote> <br /> <dd>
<dl> <dt> <em> <font>
<h1> <h2> <h3> <h4>
<h5> <h6> <hr /> <i>
<li> <nbsp> <ol> <p>
<small> <strike> <strong>
<sub> <sup> <table>
<td> <th> <tr> <tt>
<u> <ul>
-
Snippets of code should be wrapped in
<code> tags not
<pre> tags. In fact, <pre>
tags should generally be avoided. If they must
be used, extreme care should be
taken to ensure that their contents do not
have long lines (<70 chars), in order to prevent
horizontal scrolling (and possible janitor
intervention).
-
Want more info? How to link
or How to display code and escape characters
are good places to start.
|
