Hello. Welcome.
I think you want to look at BioPerl.
This code is completely untested. I didn't want to install BioPerl on my system. But it might work if you can get BioPerl installed. (I know you're new to Perl, so installing BioPerl might be a stretch, but this might help: http://bioperl.org/INSTALL.html.)
#!/bin/perl
use strict;
use warnings;
use Bio::Seq;
use Data::Dumper::Simple;
use feature "say";
# Convert the sequence to lower case. Upper Case might be ok,
# but the docs for Bio::Seq used lower case, so let's go with that.
my $letters = lc("TTCAGGTGTTTGCAACTGCGTTTTATTGCAAGAAAGAGTGGAGGGGTTTCCA
+TGGGGCCCACCTCACAACCCACTC TTCACCCCCAAAATCACGCAGGGATCGGACTCAGGAAAGGGAAG
+CATCTGTGTGTTGCATACGAGCCCTTCCTGTACTTACTTCTTTCACAGCAGGGAAGG AAGAGGGAAGA
+GGCAGCTGTGGAGAGGATCAGGTTGCGGGAGGTGGGTATCTCGCTGCTCTGACCTTACGTACAGTCCTC
+CACAGAAGCATCAAAGTGGACT GGCACATATCGGCTCCCTTCACAGGCCACAATCATCTGTCTCTCCT
+TCGGGCTGGTCCGGTATCCAC");
#Create a sequence object.
my $seq_object = Bio::Seq->new(-seq => $letters,
-alphabet => 'dna' );
#Look for the ORF. I specified the start, but I didn't see how to
#specify the stop. Are the stop codons universal? I'm way out of
#my league here.
$prot_object = $seq_object->translate( -orf => 1, -start => "atg" );
say Dumper $prot_object;
Cheers,
Brent
-
Are you posting in the right place? Check out Where do I post X? to know for sure.
-
Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
<code> <a> <b> <big>
<blockquote> <br /> <dd>
<dl> <dt> <em> <font>
<h1> <h2> <h3> <h4>
<h5> <h6> <hr /> <i>
<li> <nbsp> <ol> <p>
<small> <strike> <strong>
<sub> <sup> <table>
<td> <th> <tr> <tt>
<u> <ul>
-
Snippets of code should be wrapped in
<code> tags not
<pre> tags. In fact, <pre>
tags should generally be avoided. If they must
be used, extreme care should be
taken to ensure that their contents do not
have long lines (<70 chars), in order to prevent
horizontal scrolling (and possible janitor
intervention).
-
Want more info? How to link
or How to display code and escape characters
are good places to start.
|