Beefy Boxes and Bandwidth Generously Provided by pair Networks
"be consistent"
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??
Hello. Welcome.

I think you want to look at BioPerl.

This code is completely untested. I didn't want to install BioPerl on my system. But it might work if you can get BioPerl installed. (I know you're new to Perl, so installing BioPerl might be a stretch, but this might help: http://bioperl.org/INSTALL.html.)

#!/bin/perl use strict; use warnings; use Bio::Seq; use Data::Dumper::Simple; use feature "say"; # Convert the sequence to lower case. Upper Case might be ok, # but the docs for Bio::Seq used lower case, so let's go with that. my $letters = lc("TTCAGGTGTTTGCAACTGCGTTTTATTGCAAGAAAGAGTGGAGGGGTTTCCA +TGGGGCCCACCTCACAACCCACTC TTCACCCCCAAAATCACGCAGGGATCGGACTCAGGAAAGGGAAG +CATCTGTGTGTTGCATACGAGCCCTTCCTGTACTTACTTCTTTCACAGCAGGGAAGG AAGAGGGAAGA +GGCAGCTGTGGAGAGGATCAGGTTGCGGGAGGTGGGTATCTCGCTGCTCTGACCTTACGTACAGTCCTC +CACAGAAGCATCAAAGTGGACT GGCACATATCGGCTCCCTTCACAGGCCACAATCATCTGTCTCTCCT +TCGGGCTGGTCCGGTATCCAC"); #Create a sequence object. my $seq_object = Bio::Seq->new(-seq => $letters, -alphabet => 'dna' ); #Look for the ORF. I specified the start, but I didn't see how to #specify the stop. Are the stop codons universal? I'm way out of #my league here. $prot_object = $seq_object->translate( -orf => 1, -start => "atg" ); say Dumper $prot_object;

Cheers,

Brent

-- Yeah, I'm a Delt.

In reply to Re: REGEX help by dorko
in thread REGEX help by Mike98mm

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others rifling through the Monastery: (7)
As of 2024-04-23 12:38 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found