Beefy Boxes and Bandwidth Generously Provided by pair Networks
go ahead... be a heretic
 
PerlMonks  

comment on

( [id://3333]=superdoc: print w/replies, xml ) Need Help??

I currently load a FASTA formatted file, which contains DNA sequence separated by headers denoted by '>' i.e.:

>header1 AGACATGATCGACTGGACACAATTTACGTAGCTG >header2 AAATACTAGGGCAACACACACACACACCACACAC >header3 AGTTAGTCCAGTAGTTTACAGTACGACTGATCGT

via bioPerl (Bio::SeqIO), and store the entire FASTA file into memory as a hash:

my $fasta = $ARGV[0]; my $seqio = Bio::SeqIO->new(-file => $fasta); while(my $seqobj = $seqio->next_seq) { my $id = $seqobj->display_id; my $seq = $seqobj->seq; $sequences{$id} = $seq; } open my $IN2, '<', $ARGV[1] or die "$!"; while (<$IN2>) { # Subsample the FASTA sequences }

Or I could code it manually (which is likely quicker given the amount of overhead in Bio::SeqIO).

Based on a second input file, I then subsample the FASTA sequences and do some processing.

Each line of $IN2 includes the header from its associated FASTA sequence.

This works fine, and on modern computers the memory usage isn't too much of a problem even with larger genomes (Human etc.). Nevertheless, i'd like to take advantage of the fact that my second input file ($IN2) is always sorted by header and thus, for example, the first 5000 lines of it only need the FASTA sequence from >header1. This could potentially save me having to load the entire FASTA file into memory and instead only load the sequence that is currently being used.

I'm however having a tough time trying to figure out how to actually do this so any suggestions or code would be greatly appreciated.


In reply to Loading only portions of a file at any given time by TJCooper

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post; it's "PerlMonks-approved HTML":



  • Are you posting in the right place? Check out Where do I post X? to know for sure.
  • Posts may use any of the Perl Monks Approved HTML tags. Currently these include the following:
    <code> <a> <b> <big> <blockquote> <br /> <dd> <dl> <dt> <em> <font> <h1> <h2> <h3> <h4> <h5> <h6> <hr /> <i> <li> <nbsp> <ol> <p> <small> <strike> <strong> <sub> <sup> <table> <td> <th> <tr> <tt> <u> <ul>
  • Snippets of code should be wrapped in <code> tags not <pre> tags. In fact, <pre> tags should generally be avoided. If they must be used, extreme care should be taken to ensure that their contents do not have long lines (<70 chars), in order to prevent horizontal scrolling (and possible janitor intervention).
  • Want more info? How to link or How to display code and escape characters are good places to start.
Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Chatterbox?
and the web crawler heard nothing...

How do I use this?Last hourOther CB clients
Other Users?
Others exploiting the Monastery: (4)
As of 2024-04-25 05:21 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found