In this case, it appears that yes, move(n,m) is the only operation with cost. (I'm not sure if it's cost is constant over all n,m. I think we're supposted to assume that it is.)
In purticular, this is going to be applied to a tape-library servicing robot, which only has one operation: switch the tapes in positions N and M. (move(n,m))
You're right about bubble-sort being a possiblity... but I don't think it's a good one. Remember that it isn't finding the sequence of moves that has to be done in constant space, it's the acautual movement of physical tapes.
TACCTGTTTGAGTGTAACAATCATTCGCTCGGTGTATCCATCTTTG
ACACAATGAATCTTTGACTCGAACAATCGTTCGGTCGCTCCGACGC