Beefy Boxes and Bandwidth Generously Provided by pair Networks
No such thing as a small change

Re: Find element in array

by johngg (Canon)
on Feb 16, 2020 at 15:28 UTC ( #11113027=note: print w/replies, xml ) Need Help??

Help for this page

Select Code to Download

  1. or download this
    use 5.026;
    use warnings;
    close $dnaFH or die $!;
  2. or download this
         Sequence is GOOD!
         3 bad positions, 8.57% of total
    Sequence: ACAATAAAAGAACAATAAGAA -- Length 21
         Sequence is GOOD!

Log In?

What's my password?
Create A New User
Node Status?
node history
Node Type: note [id://11113027]
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others surveying the Monastery: (3)
As of 2020-08-08 04:15 GMT
Find Nodes?
    Voting Booth?
    Which rocket would you take to Mars?

    Results (51 votes). Check out past polls.
