Beefy Boxes and Bandwidth Generously Provided by pair Networks
Perl-Sensitive Sunglasses
 
PerlMonks  

renaming 1000's of FASTA files

by garyboyd (Acolyte)
on Jul 11, 2011 at 11:20 UTC ( #913678=perlquestion: print w/replies, xml ) Need Help??

Help for this page

Select Code to Download


  1. or download this
    F0Z7V0F01A03EB_210
    F0Z7V0F01A03EB_180
    F0Z7V0F01A03EB_136
    ...
    F0Z7V0F01A03GP_298
    F0Z7V0F01A03GP_205
    etc...........
    
  2. or download this
    >GJKKTUG01DYDGC
    GGGTATTCCTTCTCCACCTTGCAGCTAACATCAGTGTTTCGTCTACTCAAGCACGCCAAC
    ACGCCCTAGAGCGCCCTGTCCAGGGGATGGCAACCAACTCTGACCCTGCAAGTGCAGCAG
    ...
    CCTAGTTTCAAGTACTATTTAACTTACTTACGTTACCCGTAATTTCGGCGTTTAGAGGCG
    
    etc....................
    
  3. or download this
    #!/usr/bin/perl
    
    ...
    
                }
    }
    

Log In?
Username:
Password:

What's my password?
Create A New User
Domain Nodelet?
Node Status?
node history
Node Type: perlquestion [id://913678]
Approved by Corion
Front-paged by Corion
help
Chatterbox?
and the web crawler heard nothing...

How do I use this? | Other CB clients
Other Users?
Others pondering the Monastery: (5)
As of 2022-08-13 06:51 GMT
Sections?
Information?
Find Nodes?
Leftovers?
    Voting Booth?

    No recent polls found

    Notices?